Brains were cut into 1-mm 3 pieces with a razor blade and pieces further ground to dust with a pestle and mortar. 10 brains each of age-matched (12 week old) transgenic mice expressing wild-type PS1 or PS1-L286V were rapidly dissected. For an integrant clone to be selected for downstream interactome analyses it had to express the TAP-tagged PS paralog at near physiological levels and demonstrate a degree of PS endoproteolysis comparable with endogenous wild-type PS.
#R multipanel raser avoid overlap ps2
Following clonal selection by the dilution method, individual clones were analyzed by Western blot analyses to confirm PS1 or PS2 expression. After an additional 24 h of incubation, a neomycin-based selection of successfully transduced cells was initiated by the addition of antibiotic selection marker G418 (Invitrogen) to the cell medium. Subsequently, lentivirus particles were enriched by ultracentrifugation (Beckman SW32ti) at 120,000 × g for 2 h at 4 ☌, and HEK293F cells were transduced overnight with lentivirus particles. Lentiviral particles were generated by transfecting HEK293T cells with the CalPhos transfection reagent kit (Clontech, Mountain View, CA) and harvesting the cell medium after 2 days of incubation. Subsequently, TAP-PS cassettes assembled in this manner were amplified by PCR, the resulting products were digested with NdeI/BamHI and transferred into the pre-cleaved cloning cassette of the lentiviral + vector. TAP tag, PS1, or PS2 PCR products were digested with the restriction enzymes BamHI/EcoRI and PstI/XhoI (New England Biolabs, Ipswich, MA), respectively, and inserted into the pcDNA4 eukaryotic expression vector pre-digested with the same restriction enzymes. Human PS2 was amplified with primer pair TTTTTCTCGAGTCAGATGTAGAGCTGATGG and TTTTTGAATTCTGCTCACATTCATGGCCTCTGAC. Human PS1 was amplified with TTTTTCTGCAGACAGAGTTACCTGCAC and TTTTTCTCGAGCTAGATAAAATTGA from pCMV_PS1. ) through PCR with the forward primer, TTTTGGATCCGACCATGGGCACCCCCGCAGTCAC, and backward primer, TTTTTGAATTCCCGGCTCGCGCTGCCC. γ-Secretases are membrane-embedded multiprotein complexes consisting of at least four different proteins (presenilin, nicastrin, Pen-2, and Aph-1) proposed to be present in single copies in the mature complex ( Aβ is generated by consecutive cleavages of the amyloid precursor protein (APP) by two proteolytic activities, β-secretase and γ-secretase. Is the deposition of extracellular plaques, largely consisting of the 38 to 43 amino acid amyloid β-peptide (Aβ). The abbreviations used are: AD, Alzheimer disease Aβ, amyloid β-peptide APP, amyloid precursor protein CHAPSO, 3-1-propanesulfonate CID, collision-induced dissociation DDM, n-dodecyl β- d-maltoside iTRAQ, isotopic tags for relative and absolute quantitation MS/MS, tandem mass spectrometry PS, presenilins SPP, signal peptide peptidase TAP, tandem affinity purification WGA, wheat germ agglutinin TEV, tobacco etch virus BisTris, 2-2-(hydroxymethyl)propane-1,3-diol SBP, streptavidin-binding peptide SPP, signal peptide peptidase ER, endoplasmic reticulum.
Another intramembrane protease, signal peptide peptidase, predominantly co-purified with PS2-containing γ-secretase complexes and was observed to influence Aβ production.
The catenin/cadherin network was almost exclusively found associated with PS1. The analyses revealed novel interactions of the γ-secretase core complex with a molecular machinery that targets and fuses synaptic vesicles to cellular membranes and with the H +-transporting lysosomal ATPase macrocomplex but uncovered no differences in the interactomes of wild-type and mutant PS1. Brains of mice engineered to express wild-type or mutant PS1, or HEK293 cells stably expressing PS paralogs with N-terminal tandem-affinity purification tags served as biological source materials. To understand the causes for distinct phenotypes of PS paralog-deficient mice and elucidate whether PS mutations associated with early-onset AD affect the molecular environment of mature γ-secretase complexes, quantitative interactome comparisons were undertaken.
The human genome codes for two presenilin paralogs. Γ-Secretase plays a pivotal role in the production of neurotoxic amyloid β-peptides (Aβ) in Alzheimer disease (AD) and consists of a heterotetrameric core complex that includes the aspartyl intramembrane protease presenilin (PS). Glycobiology and Extracellular Matrices.
0 kommentar(er)
